This protocol is used to amplify Symbiodiniaceae ITS2 region for high throughput sequencing.
Adapted from Klepac et al. 2013 and Eckert et al. 2020.
Starting with clean DNA template that was quantified fluorescently will greatly increase amplification success.
| Reagent | 1 rxn |
|---|---|
| NFW | 22.2 µL |
| 10X ExTaq Buffer | 3 µL |
| 10 mM dNTP mix | 0.6 µL |
| SYM_VAR_5.8SII (10µM) | 1.5 µL |
| SYM_VAR_REV (10µM) | 1.5 µL |
| TaKaRa ExTaq HS | 0.2 µL |
| +1.0 µL template (25 ng total) | |
| Total : | 30 µL |
| 95 ºC | 5 min | |
| 95 ºC | 30 s | |
| 56 ºC | 30 s | 28 cycles |
| 72 ºC | 30 s | |
| 72 ºC | 5 min |
Amplify samples with the SYM_VAR forward and reverse primers (see SYM_VAR_5.8SII and SYM_VAR_REV under Primer sequence information)
Visualize on a gel using 3 µL of PCR product
Clean PCR product with Zymo DCC-5
Here we’re cleaning with Zymo DCC-5, but you can use any clean-up method
Set NFW for elution step in heat block at 65 °C
Add to your eluted DNA a 5:1 volume of Binding Buffer:DNA (e.g. 125 µL BB:25 µL PCR product) and vortex thoroughly, spin down
Transfer the entire mixture (~150 µL) to a provided Zymo-Spin Column in a collection tube
Centrifuge 16,000 x g for 2 minutes @ room temperature, discard flow through
Check to make sure all of the solution has passed through the filter, if not then spin the filter column again
Issues with getting binding buffer to pass through the filter
suggests that there may be too much DNA for the filter and it is getting
clogged, consider scraping less tissue in the beginning of the protocol
Add 200 μL DNA Wash Buffer to the column and centrifuge at 16,000 x g for 1 min @ room temperature, repeat
Transfer the column to a new labeled 1.5 mL tube and elute by adding 15–20 µL of heated NFW directly to the column matrix and incubate at room temperature for 3–5 min
Centrifuge for 2 min to elute DNA
Qubit cleaned sample and dilute with NFW for a final concentration of 5–10 ng/µL.
Now run a short PCR (7 cycles maximum) to incorporate a unique combination of indexed Illumina p5 and p7 adapters to each sample to pool for sequencing
| Reagent | 1 rxn |
|---|---|
| NFW | 6.3 µL |
| 10X ExTaq Buffer | 2.0 µL |
| 10 mM dNTP mix | 0.5 µL |
| TaKaRa ExTaq HS | 0.2 µL |
| +3.0 µL 1 µM indexed p5 primer | |
| +3.0 µL 1 µM indexed p7 primer | |
| +5.0 µL template (50 ng total) | |
| Total : | 20 µL |
| 95 ºC | 5 min | |
| 95 ºC | 30 s | |
| 56 ºC | 30 s | 7 cyclces |
| 72 ºC | 30 s | |
| 72 ºC | 5 min |
Use cleaned and diluted samples in a PCR to incorporate barcoded MiSeq-adapter primers (see Primer sequence information for information on indexed primers).
Check samples on agarose gel, you should see a single band ~450 bp
Clean PCR products and pool libraries for sequencing on MiSeq 2x250 bp
The ITS2 forward and reverse primer sequences are universal ITS2 sequences (SYM_VAR_5.8SII/SYM_VAR_REV; Hume et al. 2018) that include a linker region so that any of the barcode/index primers can be incorporated
| Primer | Sequence: 5’- MiSeq adapter + SYM_VAR -3’ |
|---|---|
| SYM_VAR_5.8SII | 5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG+GAATTGCAGAACTCCGTGAACC -3’ |
| SYM_VAR_REV | 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG+CGGGTTCWCTTGTYTGACTTCATGC -3’ |
Indexed primers that also contain the Illumina adapter needed to bind to the flow cell of the MiSeq platform can then be added to the amplified products. Dual indexing (placing unique barcode sequences on both the forward and reverse primers is a cost-efficient way to include more samples while purchasing less barcode primers (i.e. 20 forward and 20 reverse barcode primers can label up to 400 unique samples).
| Primer | Sequence: 5’-Illumina p5(or)p7 + Index + MiSeq adapter-3’ |
|---|---|
| Hyb_F1_i5 | 5’- AATGATACGGCGACCACCGAGATCTACAC+AGTCAA+TCGTCGGCAGCGTC -3’ |
| Hyb_R1_i7 | 5’- CAAGCAGAAGACGGCATACGAGAT+AAGCTA+GTCTCGTGGGCTCGG -3’ |
For more primer and barcode examples: